Concept Engine Results

Software Scientific

Research & summaries produced by Software Scientific Ltd

On 20/07/02 Software Scientific's Concept Engine ^TM read 249 documents and considered 4,849 links. From documents of any date using deep mining.

Research based on Can GM food genes cross into humans?

Relevant Documents | Related Images | Related Terms | Subject Index | Contacts

Relevant Documents

These documents are arranged in order of relevance to your query. See also Relevant Documents | Related Images | Related Terms | Subject Index | Contacts

Document	Summary

IC9826.ASM: 93% (1)
http: //www. newswise. com/ articles/ 1998/ 9/ IC9826. ASM. html: unknown date

IC9826.ASM

ⁱ The resistance may be caused by the use of other compounds that select for the same resistance genes, according to a researcher from the University of Maastricht, Netherlands 9/25/98 38th INTERSCIENCE CONFERENCE ON ANTIMICROBIAL AGENTS & CHEMOTHERAPYSEPT 24-27, 1998, SAN DIEGO CALIFORNIACONTACT: JIM SLIWA, jsliwa@asmusa.orgUsage of Antimicrobial Growth Promoters in Food Animals Poses..............:-,-,, --:. Antibiotics are, however, not only used in human & veterinary medicine, but approx 50% of the world production is fed to health food animals on a free sale basis to improve nutritional efficiency. That the intestinal flora of man & other animals is the largest pool of resistance genes & that resistant bacteria or their genes can cross species barriers, has been illustrated in several studies in which the same resistant bacteria have been found in the instestinal flora of humans in direct or indirect, via the food chain, contact with these animals. Moreover the same resistant genes could also be detected in food poisoning bacteria & strictly human pathogens. In North European countries with a low vancomycin in humans, that permitted the usage of avoparcin, a glycopeptide like vancomycin. Vancomycin-resistant enterococci (VRE) aren't only found in the intestinal flora of animals exposed to the drug, but are alo common in healthy humans. Resistance aginst newly developed antibiotics like Synercid & Ziracin is already common before these antibiotics have been used, as large amounts of closely related & cross-resistance-conferring molecules like virginiamycin & avilamycin have been fed to animals. Another threat is that these bacteria might transfer their resistance genes to other bacteria like the MRSA. As resistant bacteria of food animals pose a public health risk, a low prevalence of resistance in the fecal flora of these animals should be considered a quality & safety mark for these animals.

Impacts: Genetic Engineering: Greenpeace USA: 93% (2)
http: //www. greenpeaceusa. org/ ge/ impactstext. htm: 25/7/2001

Impacts: Genetic Engineering: Greenpeace USA

Unlike traditional crop or animal breeding, genetic engineering enables scientists to cross genes from bacteria, viruses, & even humans into plants & animals. Strawberries & flounder could never breed, but with genetic engineering, genes from fish have been inserted into strawberries & other common foods.

Superweeds: Studies have shown that GMO crops can cross-pollinate with related weeds, possibly resulting in "superweeds" that become difficult to control.

The biotech industry claims that no one has been harmed by eating GMO food. But doctors & scientists warn that there is not enough evidence to ensure that these foods are safe in the human diet.

Doctors warn that the use of antibiotic resistance genes in GMO crops may add to this risk.
These "herbicide tolerant" crops (HTCs) will likely lead to more pesticides in our food, drinking water, & the environment.

Get involved by joining the True Food Consumer Network
Visit www.truefoodnow.org, Greenpeace's website devoted entirely to genetically engineered food issues, to find out more about the campaign & what you can do.

True Food Network | GMO FACTS: 93% (3)
http: //www. truefoodnow. org/ gmo_ facts/ secret_ ingredient. html: 1/1/1970

True Food Network | GMO FACTS

ⁱ

ⁱ Thousands of products on the shelves of your local supermarket contain genetically modified organisms (GMOs)-foods from crops that havn't evolved in any natural environment but are coming from the labs of high-tech industries, from crops that have never been part of the human diet.ⁱ No Formal FDA Approval In 1992, the Food & Drug Administration decided that genetically modified foods could be marketed with no requirement for long-term safety testing or labeling, & with no formal pre-marketing approval required as is standard for any food additive.ⁱ Yet right now we are serving as the crash test dummies for the food industry's experiment on our food.Multiple Risks & Little Testing Unlike traditional crop or animal breeding, genetic engineering enables scientists to cross genes from bacteria, viruses, & even humans into plants & animals. Strawberries & flounder could never breed, but with genetic modification, genes from fish have been inserted into strawberries & other common foods.ⁱ But doctors & scientists warn that there is not enough evidence to ensure that these foods are safe in the human diet.ⁱ ⁱ Currently, the best way to avoid eating genetically modified food is to avoid processed foods, buy whole grains, fruits & vegetables, & use as much organic food as possible. More importantly, however, consumers should demand a GMO-free food supply from their food manufacturers. With your help, we can move the U.S. food industry to provide safe & healthy food produced without any genetically modified crops.

Health Implications of Genetically Modified Foods: 93% (4)
http: //www. doh. gov. uk/ gmfood. htm: 5/4/2002

Health Implications of Genetically Modified Foods

ⁱ We have examined the process involved in genetic modification of food, the areas of human health which could be affected, the safety & regulatory mechanisms which are in place & the need for further research.ⁱ

whether GM food given to animals which are then eaten by people could pose a hazard to human health.

ⁱ ⁱ

ⁱ

ii) In particular, to consider the hypothesis that the use of the recently developed technology in food might be harmful to human health;ⁱ

ⁱ ⁱ ⁱ Animals that have been genetically modified to produce pharmaceutical products for use in human therapy don't enter the food chain.ⁱ ASSESSING THE IMPACT OF GM FOODS ON HUMAN HEALTH ⁱ

ⁱ

ⁱ Traditional plant breeding increases human exposure to some of the products of these genes in a random way that doesn't 1^st involve their isolation & definition.ⁱ ⁱ There is a theoretical possibility that modified genes in GM feed might cross the gut & enter the cells of animals used to obtain human foods & this was considered in paragraphs 28 & 29.ⁱ ⁱ ⁱ ⁱ

the genetiX snowball campaign - statements - Kathryn Tulip: 85% (5)
http: //www. fraw. org. uk/ gs/ statem/ 05. htm: 17/2/2002

the genetiX snowball campaign - statements - Kathryn Tulip

ⁱ Although there has so far been limited exposure of humans to GM foods there is already evidence of risks to human health. Due to the unpredictable pattern of gene expression & function there is the potential for the production of unexpected proteins & novel toxins in GM food crops.ⁱ Genetic modification of food crops involves the transfer of a foreign gene into the host plant cell by a carrier, known as a vector, eg^? a virus or other infectious agent. While natural vectors respect species barriers, the artificial vectors made by genetic engineers are designed to cross these barriers, thus greatly enhancing the potential for creating new & possibly more virulent viral & bacterial pathogens which can in turn infect humans & animals.ⁱ There is growing concern that the use of antibiotic resistance marker genes in GM crops will exacerbate the already serious problem of antibiotic resistant infectious disease , eg^? by the spread of antibiotic resistance to human & animal gut microorganisms after eating GM crops.ⁱ Genes move between plants by cross-pollination-a process known as horizontal gene transfer . GM oil seed rape,..., has been shown to cross pollinate with ordinary oil seed rape growing 2.5 km away from the GM crop.ⁱ I believe the land & crops to be in immediate need of protection as the GM plants are just about to flower & the GM pollen will cross pollinate with neighbouring crops, causing transfer of genes from the GM crop to the neighbouring land & crops.ⁱ

Engineered Genes for Dinner: 84% (6)
http: //216. 239. 39. 100/ search? q= cache: sjHcrtwCt50C: zena. secureforum. com/ interactive/ content/ display_ item. cfm: unknown date

Engineered Genes for Dinner

ⁱ The recent news about unapproved genetically engineered (GE) corn finding its way into the human food stream should be an eye opener for everyone.ⁱ What most people don't know, however, is that much of the processed food already available on supermarket shelves may already contain GE foods. Nearly 2-thirds of processed foods contain soy products, & GE soybeans are approved for use in human food.ⁱ For those who don't know what genetic engineering is, GE foods are produced when genes from one organism are combined with genetic material from an entirely unrelated organism as a means of introducing new, supposedly desirable traits into a certain plant.ⁱ The frightening thing about this is that these foods aren't subject to any mandatory safety testing by the Food & Drug Administration.ⁱ Some scientists are also concerned that pollen from GE plants may cross- pollinate non GE-organisms, resulting in the introduction of engineered genes into our entire food stream.ⁱ its ^?possible that terminator technology could result in the loss of plant species upon which humans rely for food. ⁱ Most health food stores carry lines of food that tend to be more^? wholesome than the average supermarket.ⁱ

Biotechinfo.ie - Biotech in Action: GM Food: 84% (7)
http: //216. 239. 39. 100/ search? q= cache: oHp9wV5rfCAC: www. biotechinfo. ie/ content/ content. asp: unknown date

Biotechinfo.ie - Biotech in Action: GM Food

ⁱ ⁱ The big difference between modern biotechnology (which includes GM) & earlier cross breeding methods is that now with GM genes can be transferred from animal species to plant species & vice versa - something that did not previously happen within nature. However, by putting the growth hormone gene under the control of a gene??ⁱ However, progress is slow due to consumer concerns about 'gene flow' - the possibility that GM foods might be passed onto humans. Despite the fact that scientists have disproved the notion of 'gene flow' in humans, & that scientific evidence suggests that these foods are safe for consumption, consumers remain skeptical. ⁱ ⁱ Currently the Novel Foods Directive legislates for labelling foods with 1% GM material & over. However when some foods are processed or refined & proteins are broken down it becomes impossible to test whether that food ingredient came from a GM source or not.ⁱ Many consumer organizations in Ireland including the Food Safety Authority of Ireland, supermarkets, & Consumers Association of Ireland, feel the new law should also provide that foods with less than 1% GM content (...) material are labelled as GM foods. The new law is to cover food destined for both human & animal consumption.

http: //www. biotechinfo. ie/ content/ print_ friendly. asp? section_ id= 29& language_ id= 1: 83% (8)
http: //www. biotechinfo. ie/ content/ print_ friendly. asp? section_ id= 29& language_ id= 1: unknown date

"http: //www. biotechinfo. ie/ content/ print_ friendly. asp? section_ id= 29& language_ id= 1"

The Environmental Literacy Council - Biotechnology: 83% (9)
http: //www. enviroliteracy. org/ subcategory. php/ 5. html: unknown date

The Environmental Literacy Council - Biotechnology

Humans have been genetically modifying plants & animals for thousands of years through selective cross-breeding & domestication. In 1973, scientists Stanley Cohen & Herbert Boyer successfully transferred a gene from one organism to another. Recent controversy about biotechnology has focused on food products. Traditional methods of cross-breeding crops take many years of experimentation. its ^?also possible to transfer traits from species that cannot cross-breed. EG^?, genes in arctic salmon that make the fish resistant to cold can be transferred to tomatoes to protect them from frost. In 1994, the 1^st food products from this new technology began reaching the market, including the FlavrSavr tomato & a breed of potatoes genetically modified to produce an insect-killing protein.ⁱ Other questions concern the potential of "gene jump," the potential of the antibiotic markers used in gene transfer increasing antibiotic resistance in humans. ⁱ

NFSD: Biotechnology and Food: 83% (10)
http: //www. agen. ufl. edu/ ~foodsaf/ wi004. html: unknown date

NFSD: Biotechnology and Food

ⁱ

Examples of Foods from Plants Modified Through Genetic Engineering, The Gene Exchange (...)

ⁱ The California company that developed the FLAVR SAVR tomato has inserted 2 genes into these tomatoes using recombinant DNA techniques: the antisense PG gene - which is difficult to detect - linked to a marker gene that makes plant cells resist an antibiotic called kanamycin.ⁱ So the kan-resistance gene is linked to the antisense PG gene to make it easy to find those cells that both resist the kanamycin & have the antisense PG gene that keeps tomato fruit firmⁱ ⁱ In Jan 1993, Calgene also asked FDA to review the kanamycin-resistance marker gene & its protein as a food additive in tomato, cotton & canola.

Kanamycin-resistance marker gene & its protein as a food additive.

Note that only the kanamycin-resistance gene - not the FLAVR SAVR tomato - was reviewed as a food additive.ⁱ

Will the kan-resistance gene protein cause food allergies in some people?
Will the kan-resistance gene protein affect kanamycin's usefulness as an antibiotic for humans?

ⁱ

Human Genome News: 83% (11)
http: //www. ornl. gov/ hgmis/ publicat/ hgn/ v12n1/ 06gmproducts. html: 12/3/2002

Human Genome News

At the Courts 1^st International Conversation on EnviroGenetics Disputes & Issues, held in Hawaii in July 2001, scientists & judges discussed technical & societal issues surrounding the genetic modification (GM) of plants & other organisms (for an overview of the meeting, see Genes, Justice, & Human Rights).ⁱ The most controversial issues fueling worldwide debate on GM products focus on human & environmental safety, labeling & consumer choice, intellectual property rights (...), ethics, food security, poverty reduction, & environmental conservation. ⁱ Issues that need addressing, he continued, include more precise targeting of genes, cross-pollination by GM organisms in the wild, effects on biodiversity & ecology, & labeling. ⁱ Antibiotic resistance A controversial aspect of GM technology is the use of antibiotic-resistance genes as markers to help locate cells in which gene transfer was successful. The concern is that such genes may be transferred to intestinal bacteria in humans, but there is little evidence of this occurrence.ⁱ Controversy arose when GM corn was inadvertently mixed with non-GM corn & ended up in several human food products eg^? taco shells.ⁱ Environment Goldburg also described how a GM food might pose a risk to the environment, giving the example of transgenic salmon that probably will be the 1^st GM animal food to come to market.ⁱ She suggested that by 2010 there would be many improvements in biotech foods, including the elimination of food allergens; rotating use of many biological pesticides to avoid resistance; construction of artificial chromosomes; & control of cross-pollination problems. ⁱ

DECLARATION OF RABBI ALAN GREEN: 83% (12)
http: //www. bio- integrity. org/ greendeclaration. html: 26/3/2001

DECLARATION OF RABBI ALAN GREEN

ⁱ These laws govern my choice, preparation & consumption of food. They specifically prohibit certain types of foods, food additives & ingredients, including those containing substances from insects & certain types of animals.ⁱ I am informed that several types of food-producing plants have been engineered to contain genetic material from insects & that some researchers have even spliced human genes into plants. As the FDA doesn't require pre-market notification & labeling of genetically engineered foods, I & my family don't know for sure whether these foods are still in developmental stages or are already on supermarket shelves. Further, not only do the Hebrew scriptures impell my religious objections to foods containing genes from prohibited species, they -- along with rabbinical tradition -- prompt me to avoid all genetically engineered foods in general, even if the food doesn't contain genes from species that are specifically prohibited.ⁱ I further believe that the way in which recombinant DNA technology is currently being employed in food production is truly an extreme disruption of these natural boundaries & that its products are in general imbued with a spiritually degraded energy which remains with substances derived from the whole organism & transfers with them into other foods in which they become ingredients.ⁱ No other technique can fuse genes from vastly different species; none other consistently creates such disturbance to the DNA of the involved organism(s); none other relies upon promoters from viruses to drive expression of the transferred genetic material (...). As the defendants don't require the labeling of genetically engineered foods, its ^?difficult for me to know whether the foods that I am buying, preparing & consuming (...) are in keeping with my beliefs.ⁱ

True Food Network | GMO FACTS: 83% (13)
http: //www. truefoodnow. org/ gmo_ facts/ ge_ defined. html: 20/8/2001

True Food Network | GMO FACTS

ⁱ

Since the time that humans 1^st started cultivating plants & raising animals for food, we have been striving to make food healthier & food production more efficient. Using the natural mechanisms of cross-breeding,..., we have been able to affect the biological traits of offspring by selecting & mating the parents that carry the traits we desire. Cross-breeding can only take place between species of plants & animals that are closely related genetically. ⁱ There are literally millions of genes in a living organism & they don't just work on a "one gene, one trait" system.ⁱ Animal genes are going into plants, bacteria genes into food crops, & even human genes are being used to change animals & plants. Already in the lab a human gene has been added to salmon, trout, & rice; a chicken gene to potatoes; a fish gene to strawberries, mouse genes into tobacco; & bacteria & virus genes into cucumbers & tomatoes. ⁱ Governments have expressed fears that crops containing an ampicillin resistance gene could undermine the treatment of human & animal disease.ⁱ Scientists at Riso National Lab in Denmark have found that, through spontaneous cross-fertilization, genetically engineered canola can pass its herbicide resistance genes to weedy relatives.ⁱ

http: //www. iol. ie/ ~plugin/ badfoods. htm: 83% (14)
http: //www. iol. ie/ ~plugin/ badfoods. htm: 7/9/1999

"http: //www. iol. ie/ ~plugin/ badfoods. htm"

ⁱ It would make sense if everyone could find exactly WHAT they a re eating, before it's too late & irreversible damage is done to the human food chain - if it hasn't already, that is.ⁱ Decent, wholesome food is the right of every human being - & of every animal. Many scientists are becoming increasingly worried about the 'Doomsday Scenario' genetically engineered foods could create - with basic foodstuffs becoming dangerous, GE (...) foods could wipe out the human race, instead of being a solution to feed starving & undernourished world populations.ⁱ ⁱ If this gene is taken up by disease bearing organisms in the human body, those organisms would also become immune to ampicillan - in other words,antibiotics now used to control disease & infection in human beings & animals won't work any more . Of course, once the pesticide is 'inside' ALL the potatoes which are grown, then if it proves harmful to humans or mutates in any other way, ALL potatoes will be useless as food.

1) Quotation from an article entitled " Big Issues in Small Loaves" by Joanna Blythman in "COUNTRY LIVING" magazine, Apr 1997 :-- "Some of the 3,000 proposed gene foods include apples that don't brown when peeled, & fast-growing salmon". The Daily Mail's article above is also a warning that oranges have obviously been added to the list of 3000 or more foods whose genes are being tampered with to force extra profits from humanity's obvious need to eat.

When absorbed into the human body in food or drink, Aspartame breaks down into formaldehyde, a chemical which is known to cause several harmful effects to health (...). ⁱ

CDC - The Antibiotic Food-Chain Gang: 81% (15)
http: //www. cdc. gov/ ncidod/ eid/ vol7no3/ courvalin_ letter. htm: 6/7/2002

CDC - The Antibiotic Food-Chain Gang

To the Editor: In his reply to my letter (1), Dr. Shryock states that use of the growth promoter avilamycin,..., was in compliance with the Swann principles. The Swann report, issued in 1969, recommends that antibiotics used to treat infections in humans not be used as animal-food additives (2). It appears that more than 30 years was necessary for the animal-food industry to act in accordance with the Swann report. The implication is that drugs that are chemically closely related have the same target of action & are therefore subject to cross-resistance, & vice versa.ⁱ As of the genetic organization resulting in co-expression of the various genes, use of any antibiotic that is a substrate for one of the resistance mechanism will co-select for resistance to the others & thus for maintenance of the entire gene set. Since cross-resistance means cross-selection & co-resistance implies co-selection, the use of any antimicrobial agent is de facto rendered inadequate as a growth promoter. I also disagree with the notion that as a member of an antibiotic class has been misused as a growth promoter the class shouldn't be used in the future for human therapy; the hierarchy could conceivably be humans 1^st, animals 2^nd, rather than the opposite.ⁱ

Mobile gene cassettes & integrons: moving antibiotic resistance genes in gram-negative bacteria.

Basic Information Page...: 81% (16)
http: //www. bio- integrity. org/ Overview. html: 26/3/2001

Basic Information Page...

ⁱ

New Risks to Our Food

(a)

ⁱ

(a)

ⁱ

(FDA)

Other documents on our website more fully discuss the points in this overview & explain why every individual has reasonable grounds to reject gene-tampered foods & oppose the enterprise that is producing them out of concern for both personal safety & environmental protection.

Simply News - The Risks of Genetic Engineering: 81% (17)
http: //www. simplyliving. org/ sl/ simnews/ slnon9a6. htm: 18/4/2002

Simply News - The Risks of Genetic Engineering

ⁱ We gawk at movies about attempts to create a race of super-humans gone terribly awry. Today, an estimated 60-70 ^% of all packaged food on American grocery store shelves contains genetically altered ingredients. None of the federal agencies which regulate food production--the Food & Drug Administration, the Department of Agriculture or the Environmental Protection Agency--requires genetically engineered products to be labeled, violating consumers' rights to avoid them. Although long term effects aren't yet known, we can anticipate that eventually, through cross-pollination & natural selection, insects & weeds will likewise become resistant to the pesticide & herbicide altered plants. A growing fear among organic farmers is the genetic splicing of the Bt (...) bacterial genes into seeds. As plants which contain the Bt genes--eg^? Monsanto's "New Leaf Superior" potato--are being widely cultivated, insect resistance will likely occur quickly. Through natural cross-pollination, the new traits developed through gene splicing can be carried into surrounding fields & wild areas.ⁱ We are equally unaware of the long-term affects on humans & animals who consume genetically altered food.ⁱ

Gene technology and plants-Key text: 81% (18)
http: //www. science. org. au/ nova/ 009/ 009key. htm: 13/2/2002

Gene technology and plants-Key text

Gene technology, also known as genetic engineering, involves manipulating or transferring genetic material within or between organisms.

You will get more from this topic if you have mastered the basics of DNA & genes – this link will take you to an annotated list of sites with helpful background information.
Many scientists in the early part of this century further advanced our knowledge of gene transmission. In the following decades, scientists discovered the molecular nature of genes & their products.
Gene technology provides a new tool
ⁱ Gene technology not only gives us the potential to select the exact characteristics we want in an organism, but it also enables us to cross species barriers.ⁱ This new-found ability to cross species barriers is what makes gene technology such a powerful tool.ⁱ

Genetically modified organisms that end up as human food come under the umbrella of ANZFA.ⁱ
ⁱ

Austin Chronicle: Most Commonly Altered Crops: 81% (19)
http: //www. austinchronicle. com/ issues/ vol18/ issue49/ food. genetic. side1. html: unknown date

Austin Chronicle: Most Commonly Altered Crops

	Scientists were able to isolate the gene responsible for the production of ethylene gas in the fruit & insert it "backward" to slow down or stop the ripening process. Experiments were also done inserting genes from cold-water fish into tomatoes.		The FDA's checklist for biotech foods contained the following 4 questions: Does the food have the same nutrients as other foods?ⁱ Is the food basically like other foods?ⁱ
			Though the FDA has yet to establish acceptable levels for antibiotic resistance in humans, the Time article states that the FDA is in the process of "forming a plan for pulling antibiotics off farms & ranches when human resistance develops."
	Genes from Bacillus thuringiensis toxins, a common soil bacterium that is nontoxic to humans & many other animals, are spliced into potato seed.
	ⁱ		No tests have been done on the long-term dangers to humans ingesting foods that are prepared or manufactured with "Round-Up Ready" soy products.ⁱ
			No tests have been done on the long-term dangers of humans ingesting treated canola oil or foods that have been manufactured with it.ⁱ

ⁱ

Genetically Modified Crops: Not "in England's Green and Pleasant Land"?: 81% (20)
http: //www. foodstuff. org/ News/ OnThePlate/ April99. htm: 29/3/2002

Genetically Modified Crops: Not "in England's Green and Pleasant Land"?

ⁱ 3, March 1999) we reported on the public controversy surrounding genetically modified crops & food products in the UK^?. Campaigns to ban or delay the introduction of genetically modified food products are supported by some of the big newspapers in the U.K.Here is a guest article that appeared in an earlier version in the Wall Street Journal Europe. The techniques for selecting GM plants don't rely on the human eye & stomach for guidance to nearly the same degree as conventional cross-breeding: marker genes & molecular & compositional analysis of plants make selection far easier & more precise. In addition, the characteristics of the particular gene being inserted into the plant are established using complex techniques eg^? polymerase chain reaction & gene sequencing, which ensures that they are well known prior to insertion.ⁱ Had the adventurous apiarists who created the Africanized honeybee been able to identify & successfully insert the gene from the African bee that encodes for high honey production, they would have been able to produce a high-output European honey bee instead of an aggressive cross-breed. ⁱ By contrast, the modern techniques of genetic modification that have been in use since 1983 are precise & predictable: a gold pellet containing the desired gene from plant (...) B is fired into the chromosome of plant A. In addition, a "marker" gene is added which creates resistance either to an herbicide or a toxic antibiotic so that when the plants are sprayed with these substances only those that have the new gene will survive,..... Greenpeace, Friends of the Earth, & several other activist groups raise the alarm that GM crops' genes will "drift" onto crops grown conventionally & cross-pollinate them.ⁱ In fact, so stringent are they that people are almost certainly better off buying GM foods than foods that have been developed using conventional techniques. ⁱ

What is GM? | About GM | Genetic modification in New Zealand: 81% (21)
http: //www. gm. govt. nz/ about- what. shtml: unknown date

What is GM? | About GM | Genetic modification in New Zealand

GM in NZ | Control of GM | GM research | Medicines | Food | Royal Commission on GM | What next? | ⁱ Genes can be altered, switched on or off, or moved between unrelated species.Genetic modification means that for the 1^st time humans can make living things to our own design, without relying on nature. A ‘genetically modified organism’ is a plant, animal, insect or micro-organism whose genetic make-up has been changed using modern gene technology, eg^?, by adding new genes or changing the function of genes already present. New genes may come from the same or different species or may be synthetic. A ‘genetically modified organism’ is a living thing that can grow & reproduce, & can pass on its modified genes to its offspring.ⁱ Humans have about 35,000 genes, but about 99 ^% of our genes are shared with chimpanzees, & about 80 ^% are shared with other mammals eg^? mice & sheep.ⁱ

Cross-species tissue transplants (...), which involves transplanting tissues from one species into another eg, using tissue or organs from pigs for transplant into humans.ⁱ

Department of Food Science and Technology List of Publications 1999: 81% (22)
http: //www. fst. rdg. ac. uk/ misc/ ann98. htm: 19/5/2000

Department of Food Science and Technology List of Publications 1999

In: "Quality Attributes of Muscle Foods". Ames, J.M., Wynne, A., Hofmann, A., Plos, S. & Gibson, G.R. The fermentation of Maillard reaction products by human large intestinal bacteria. Food Chem., Food Sci., Bellara, S.R., Fryer, P.J., McFarlane, C.M., Thomas, C.R., Hocking, P.M. & Mackey, B.M. Visualisation & modelling of the thermal inactivation of bacteria in a model food. In Food Microbiology & Food Safety into the Next Millenium. Suau, A., Bonnet, R., Sutren, M., Godon, J.J., Gibson, G.R., Collins, M.D. & Dore, J. Direct analysis of genes encoding 16S rRNA from complex communitiesreveals many novel molecular species within the human gut.ⁱ Williams, C.M., Francis-Knapper, J.A., Webb, D., Brookes, C.A., Zampelas, A., Tredger, J.A., Wright, J., Calder, P.C., Yaqoob, P., Roche, H. & Gibney, M.J. Cholesterol reduction using manufactured foods high in monounsaturated fatty acids, a randomised cross-over study.ⁱ

Do Plants Have More Genes the Humans?: 74% (23)
http: //www. cps- scp. ca/ moregenes. htm: 12/12/2001

Do Plants Have More Genes the Humans?

DO PLANTS HAVE MORE GENES THAN HUMANS?

ⁱ Both the International Human Genome Sequencing Consortium & Celera Genomics came to similar conclusions, with estimations of 31,00032,000 genes [1,2].ⁱ The small number of predicted genes was surprising given the large collection of human cDNAs.ⁱ Indeed, many of the sequenced human genes have alternative splice products. Therefore, the number of human protein products could far exceed the number of genes. Interestingly, although its ^?only one-thirtieth the size of the human genome, the predicted number of genes in Arabidopsis thaliana (25,500) is in the same league as the predicted number of human genes [3].ⁱ Therefore, a fundamental difference between plants & humans might be that although the gene content of plants can be much higher, the number of protein products is much lower compared with humans.ⁱ

Biotechnology & Food: 74% (24)
http: //216. 239. 39. 100/ search? q= cache: PiTECIAgXh4C: www. sciencesavvy. com/ UWEXUpdates/ Food: unknown date

Biotechnology & Food

ⁱ Humans get food by hunting & gathering wild animals, plants or microbes, or by domesticating animals into livestock or cultivating plants into crops & developing microbes into microbial cultures (...). ⁱ Humans select or develop crops, livestock & microbial cultures based on traits favorable to humans. ⁱ To generate better varieties of crops, livestock & microbes, humans can manipulate the genes, humans can modify the environment, or humans can modify both the genes & the environment. ⁱ Genetic variation is expressed in the term "gene pool": all the genes available to a breeder useful in improving a breed through generating combinations of genes that result in superior traits. ⁱ Until 1973, the gene pool for a corn breeder was limited to corn & its close relatives that could cross-pollinate with it. ⁱ The changing & moving of DNA, that is, the changing & moving of genes, by nature alone or by the hands of humans present risks of changing the traits for ill as well as for good. ⁱ Succinctly, foods from gene-spliced crops are as safe as foods from conventionally-bred crops, for the same trait. ⁱ

Selective Breeding & Inbreeding Depression: 74% (25)
http: //www. biology- online. org/ 2/ 12_ selective_ breeding. htm: 20/6/2002

Selective Breeding & Inbreeding Depression

Most notably, Gregor Mendel's studies into Monohybrid & Dihybrid crossing & Charles Darwin's study of evolution & natural selection has meant that humans have learnt to actively manipulate the phenotype of offspring by selective breeding in animals & plants. Since both these organisms have dominant genes for these desirable characteristics, when they are crossed they will produce at least some offspring that will show ALL of these desirable characteristics. Most professional breeders have a true breeding cross (...) so that they will produce a gene bank of these qualities that can be crossed with aaBB to produce heterozygous offspring.

However, while its ^?an advantage both to the species & to humans to produce these desirable qualities that may benefit the organisms in question, continuous in-breeding & selective breeding of particular genes runs the risk of losing some of the other genes from the gene pool altogether, which is irreversible.ⁱ
Genetic diversity means the gene pool of a species is prepared for a wide range of scenarios eg^? food shortage or an epidemic of disease.ⁱ

With this in mind, humans have gene banks to preserve the genetic information in the case of extinction, & nurture species that are at dangerously low population levels.

Ironically, the human interference that has disrupted so many species can now provide a means of placing genes into organisms, therefore preparing them for the above hypothetical scenarios eg^? an epidemic of disease.

Judicature: Judicature: Genes, Dreams, and Reality: 73% (26)
http: //www. ornl. gov/ hgmis/ publicat/ judicature/ article3. html: 20/1/2000

Judicature: Judicature: Genes, Dreams, and Reality

ⁱ Many of the new genetic discoveries stem from data & tools generated by the massive international Human Genome Project (HGP), whose goal is to describe in intricate detail the DNA from humans & other selected organisms by 2003.ⁱ Fewer than 100 gene tests are available commercially, & most are for mutations associated with rare diseases in which just a single gene is involved (see "Some currently available gene tests").ⁱ This rapidly developing fieldcalled gene transfer or gene therapyholds great potential for treating or even curing such genetic & acquired diseases as cancers & AIDS by using normal genes to replace or supplement defective genes or bolster a normal function like immunity.ⁱ Gene-transfer technologies already are being used to transfer human genes into farm animals eg^? sheep & goats for the purpose of generating large quantities of expensive human proteins for use as pharmaceuticals. The animals carrying human genes are called "transgenics" & are difficult & expensive to develop.ⁱ Current research is aimed at using DNA technologies to grow organs having human genes that make the organ's surface more "human like" & may help to minimize the chance for rejection upon transplantation into a human host.ⁱ A potential health concern is that genes producing allergy-inducing proteins (...) could be introduced into other food plants & consumers might unknowingly ingest a substance to which they could be allergic.ⁱ

Institute of Food Science & Technology: BSE/vCJD: 73% (27)
http: //www. ifst. org/ hottop5. htm: 8/12/2001

Institute of Food Science & Technology: BSE/vCJD

BOVINE SPONGIFORM ENCEPHALOPATHY (BSE) & VARIANT CREUTZFELDT-JAKOB DISEASE (vCJD) IN HUMANS

ⁱ

UK human health control from mid-1996: From Aug 1996 strict enforcement of the ban on mammalian MBM for all farm animals, exclusion of SRMs from the food chain, & slaughter of cattle aged over 30 months (the OTMS) + a cattle traceability scheme led to the lifting in Nov 1998 of the EU-imposed global ban on British..,..........- ()-.
GBR is not an indicator of a risk to humans via food consumption, but a qualitative indicator of the risk that live cattle could be infected with the BSE agent & incubating the disease.
Although the scientific evidence doesn't prove a causal connection, the evidence is consistent with the transmissibility of BSE infectivity to at least some humans (...); & taken in conjunction with related circumstances it increases the likelihood of a causal connection.

ⁱ ⁱ As the mouse & human genomes are so similar its ^?almost certain that corresponding genes in humans will be found which have the same role to play, & further work in mice & humans will now need to be done. ⁱ

ⁱ

In its reports of June 2001, the EU Scientific Steering Committee carried out risk assessments of various raw materials & production processes for gelatin http://europa.eu.int/comm/food/fs/sc/ssc/out218_en.pdf updated on 6-7 Sept 2001 http://europa.eu.int/comm/food/fs/sc/ssc/out227_en.pdf& tallow ://..//////_.- ://..//////_.

The 1^st of these served, also as part of the precautionary programme of measures to protect human health, in case transmissibility to humans might occur. ⁱ

VITAMINC.VTU: 73% (28)
http: //www. newswise. com/ articles/ 2001/ 7/ VITAMINC. VTU. html: unknown date

VITAMINC.VTU

Library: MED Keywords: VITAMIN C, PLANTS, GENE, FOOD, HYBRIDIZATION Description: Someday maybe a salad will be just as rich in vitamin C as a glass of orange juice since genes from a rat have been found to increase the vitamin in lettuce. Rat Genes Increase Vitamin C in PlantsGenes from the lowly rat may hold the key to increasing Vitamin C in the world's food supply. Craig Nessler, head of plant physiology, pathology, & weed science at Virginia Tech, has found that by transferring certain rat genes into lettuce, he can turn on the plant's latent Vitamin-C-producing pathway.ⁱ He & his colleagues are using what they've learned from the rat-gene work to try to discover other ways to stimulate the Vitamin C gene in lettuce & other plants.Nessler chose to use rats in his research as the gene was readily available & rodents are natural producers of Vitamin C."The reason sailors on their way to the new world got scurvy while rats thrived was as humans have lost the ability we once had to make our own Vitamin C, while rats have retained it," he explains. Humans still have the gene, but a genetic defect has rendered it inoperative.ⁱ Shortly after he & his colleagues had successfully introduced the gene into lettuce, another scientist's paper stated that plant & animal biochemical pathways differed so much that animal genes could not work in plants.ⁱ

Genetics and plant biotechnology: 73% (29)
http: //www. jic. bbsrc. ac. uk/ exhibitions/ bio- future/ genetics. htm: 22/6/1999

Genetics and plant biotechnology

ⁱ The basic mechanisms for inheritance are remarkably similar for most organisms: whether we consider flower shape or a person’s eye colour, the characteristics are determined by genes, passed from parent to offspring. Genes – the code of life Genes are the blueprint or code for inheritable characteristics, which usually means they direct the production of specific proteins. Genes control all of life’s processes, & they therefore need to work properly.ⁱ The individuality & function of a gene are determined by the number of these building blocks, & the particular order in which they are strung together – this is known as the sequence of the gene.ⁱ The ability to manipulate individual genes is what distinguishes genetic modification from conventional breeding, whereby all the genes of both parent plants are randomly mixed & sorted. Improving crops: genetic modification versus plant breeding Ever since our ancestors changed from being ‘hunter-gatherers’ to farmers, in an attempt to ensure a more reliable food supply, humans have been modifying the genetic make-up of crop plants to provide tastier, more nutritious & more plentiful crops.ⁱ However, as cross-breeding involves a random mixing & sorting of genes from both parental plants, this is a slow process.ⁱ

hudsonvalleyfood.com - Food and Your Health: 73% (30)
http: //www. hudsonvalleyfood. com/ _specialty/ _hvfood/ health. htm: 27/11/2001

hudsonvalleyfood.com - Food and Your Health

Food & Your Health - Reliable, up-to-date news & research on food-related issues, written by Dr. Toby Rossman, Prof at the Nelson Institute of Environmental Medicine, New York University School of Medicine.

ⁱ Some have even called genetically-modified food Frankenstein foods. Here I describe in lay-persons terms exactly what is meant by genetically-modified food & genetically-engineered foods.ⁱ Ever since humans stopped hunting & gathering for a living & became farmers, we have been genetically modifying our food.ⁱ The information contained in a gene consists of about 1000 bases in a particular order (eg^?, part of a gene might read GCGGTTACCAAGTTCGGAAA).ⁱ Genetic engineering of foods Genetic engineering allows genes from any organism, not just a genetically compatible close relative, to be added to a plant (...).ⁱ This question was brought up by those who worry that if a gene were derived from a non-kosher species, eg^? a crab, then the resulting food would not be kosher.ⁱ

future.newsday.com / The Future of Food, Bioengineering: 73% (31)
http: //future. newsday. com/ 3/ ftop0328. htm: unknown date

future.newsday.com / The Future of Food, Bioengineering

Newsday Photos/J. Michael Dombroski Genetically engineered food may gain in popularity.

ⁱ In this new world, bioengineers use high-tech "gene guns" to splice new DNA into vegetables & farm crops before farmers plant them; the device bombards plant genes with new genes from bacteria, viruses, other plants & even animals, altering crops to give them new attributes -- with fish.,.,.....ⁱ Among the potential dangers that some biologists warn of -- though biogeneticists dismiss them -- are the creation of super-resistant weeds that pick up biological pesticide genes through cross-pollination, or super-bugs that develop genetic resistance to the pesticides in altered plants.ⁱ With or without genetic engineering, in recent years, the line between food & medicine has blurred with the increase in the manufacture of "nutraceuticals," foods that promise health benefits as of added ingredients.ⁱ Norvartis has already engineered corn -- by adding protective bacteria & virus genes to corn genes -- that is resistant to corn ear worm & European corn borer.ⁱ Forty ^% of the food grown today is lost to spoilage, insects, disease, post-harvest losses," said Val Giddings, VP^? for food & agriculture at the Biotechnology Industry Organization trade group.ⁱ Giddings, of the Biotechnology Industry Organization, scoffed at the idea that bioengineered food crops threaten the food supply.ⁱ

NFSD: Biotechnology and Food: 72% (32)
http: //www. agen. ufl. edu/ ~foodsaf/ wi008. html: unknown date

NFSD: Biotechnology and Food

ⁱ If a child receives 2 copies of the defective gene called the CF gene - one copy from each parent - then the child will develop the disease.ⁱ genetic analysis - Studying how traits & genes for traits are passed from generation to generation, & how genes & the environment interact to result in traits. genetic engineering - Using recombinant DNA techniques & related methods to move one or several genes from one organism to another, to rearrange one or several genes within a cell, or to alter gene-controlled processes. human growth hormone - Human somatotropin, a protein hormone made in the pituitary gland. Lab-grown (HGH) bacteria given a copy of the gene for human growth hormone can then produce large amounts of HGH, which can be purified & used to treat certain kinds of human dwarfisma pathological condition of growth arrested by various causes. In the lab, microbes given a copy of the gene for human insulin can make insulin to treat diabetes mellitus, a shortage of insulin.ⁱ Attaching a marker gene to another gene that is hard to find, eg^? an antisense gene, is like putting a reflective collar on a dog so you can see the collar at night - even though you cannot see the dog, you know where it is.

GMO Full: 72% (33)
http: //www. scienceinafrica. co. za/ GM_ Full. htm: 10/1/2001

GMO Full

& wheat would probably not be passed by food regulatory authorities if it were introduced today as of the numbers of people who are allergic to it. ⁱ It will certainly never displace breeding - indeed genetic engineers are heavily dependent on plant breeders to ensure any introduced gene exists & operates in concert with the other genes of the plant.ⁱ Therefore, once the genes have been introduced a great deal of work is required to ensure that the inserted genes & the plant's own genes work harmoniously together. ⁱ Let us look at safety of foods derived from GM crops for human & animal consumption. 1^st of all its ^?important to realize that there is no such thing as safe food - there is only the safe use of food.ⁱ Certainly we should stop wars, eliminate corruption so that food gets to the right people, build roads & rails to transport the food, but how long will that take? As Europe has enough food & don't want GM foods should we allow them to dictate to us as to what is best for Africa?

CSREES -: 72% (34)
http: //www. reeusda. gov/ pas/ programs/ foodsafetyresearch/ foodresearch. htm: 29/5/2002

CSREES -

ⁱ Learning more about the characteristics that allow this organism to colonize food animals can lead to the development of vaccines & other treatments to prevent colonization & therefore prevent its transmission to humans via food.ⁱ The genes they identify associated with colonization may be known already, may be genes that are known but not previously known to function in colonization, or may be completely novel genes. The goal of this study is to discover novel genes or genes previously unknown to affect colonization.ⁱ To do this, they will identify the genes that determine host-specificity in 2 serovars of Salmonella enterica: Salmonella Enteriditis,..., chickens, & mice, & Salmonella Pullorus, a host-specific serovar that only infects chickens.ⁱ These results indicate that Pullorum has all of the genes needed to cause an infection in mice, but that the regulation of these genes differs from that in Salmonella serovars that are less host-specific. The researchers have used this discovery to develop an initial reporter gene assay to help identify the genes involved.ⁱ In the coming year, the researchers will continue studies to develop a modified live vaccine that protects against Salmonella infection, extend their cross-protection studies done in mice & chickens to determine if cross-protection can be elicited in calves, & initiate studies on the developments of a killed Salmonella vaccine using a mouse model...

ⁱ

http: //www. ausbiotech. org/ edu3. html: 71% (35)
http: //www. ausbiotech. org/ edu3. html: 18/9/2001

"http: //www. ausbiotech. org/ edu3. html"

Biotechnology for agriculture: more for less Ever since humans 1^st farmed for survival, crops have been ruined by bacterial & viral infection, attacked by insects, eaten by worms, choked & weakened by weeds & damaged by unpredictable weather. ⁱ The developing techniques of biotechnology, applied to modern agriculture, offer an additional tool in our constant battle to provide more food at a reasonable price for the world's growing population. Biotechnology in the past For many years, farmers have sought to improve their crops by a process called cross pollination. Individual plants with desired traits are selected & artificially cross pollinated, in the hope of producing offspring that share those traits. As our knowledge of classical genetics has increased, so has our ability to predict the outcome of particular cross breeding strategies. However, despite this knowledge, cross breeding remains a somewhat hit or miss affair & its ^?expensive in both time & money.Genetic Engineering Scientists now understand the coding system underlying the chemical instructions, or genes, that are passed on from one generation to the next.ⁱ

Guardian Unlimited | The Guardian | Cult determined to clone humans: 67% (36)
http: //www. guardian. co. uk/ international/ story/ 0, 3604, 523779, 00. html: unknown date

Guardian Unlimited | The Guardian | Cult determined to clone humans

Cult determined to clone humans US company to fight Congress attempt at ban on human cloningSpecial report: the ethics of genetics Michael Ellison in New YorkThur July 19, 2001The Guardian With the president of the United States, his health secretary, the food & drug administration, anti-abortionists & feminists..,......ⁱ Ms Boisselier, who has doctorates in chemistry from universities in Dijon & Houston, is scientific director of Clonaid & says that her team will produce the 1^st human clone soon. "Humanity will benefit," she said yesterday. "This is good for infertile couples who have serious problems & for people who want to have a baby & don't want to mix their genes, people who prefer to clone themselves. Congress has been told that President Bush & the health secretary, Tommy Thompson, oppose human cloning. The FDA says that human cloning must have its approval, which it won't give: a decision Ms Boisselier plans to challenge in the courts. Human cloning would work in the same way, producing a genetic twin by putting an individual's DNA into an unfertilised egg which has had its centre removed.ⁱ

The Environmental Literacy Council - Land: 62% (37)
http: //www. enviroliteracy. org/ category. php/ 2. html: unknown date

The Environmental Literacy Council - Land

Human activities also shape the land in many ways. Deforestation, eg^?, is a major contributor to observed increases of carbon dioxide in the atmosphere from human sources. Issues related to land use include how to meet human needs for food & natural resources while preserving important habitats & how to remediate land that has been altered or despoiled by intensive use.

Dangers of Genetic Engineering—Campaign for mandatory labeling of genetically engineered food: 62% (38)
http: //www. safe- food. org/: 24/10/2001

Dangers of Genetic Engineering—Campaign for mandatory labeling of genetically engineered food

ⁱ Genetic engineering is the largest food experiment in the history of the world. There are about 40 varieties of genetically engineered crop approved for marketing in the U.S. As a result, 60-70% of the foods on your grocery shelves contain genetically engineered (GE) components. Genetically engineered foods contain substances that have never been a part of the human food supply. Join us, sign our petition, & work with us to push food safety to the forefront of our national public awareness.

webmaster@safe-food.org

The Environmental Literacy Council - Environment & Society: 62% (39)
http: //www. enviroliteracy. org/ category. php/ 5. html: unknown date

The Environmental Literacy Council - Environment & Society

Humans, as do all living organisms, depend on the natural world for vital nutrients, water, & shelter. Yet, humans have a greater capacity to alter their environment than other organisms. Humans have modified their environments since they 1^st began clearing land for agriculture. A larger population & an expanded agricultural & industrial capacity have increased human use of natural resources. The challenge is to meet the human needs of a growing population in ways that minimize costs to natural resources & living things.

THE MERCK MANUAL--Home Edition, Sec. 15, Ch. 162, Causes and Risks of Cancer: 55% (40)
http: //www. merck. com/ pubs/ mmanual_ home/ sec15/ 162. htm: unknown date

THE MERCK MANUAL--Home Edition, Sec. 15, Ch. 162, Causes and Risks of Cancer

ⁱ Another gene (the RAS oncogene) makes the adenoma grow more actively. The subsequent loss of a suppressor gene on chromosome 18 further stimulates the adenoma, & finally the loss of a gene on chromosome 17 converts the benign adenoma to cancer. Some breast cancers are linked to a specific gene mutation, more common in some ethnic groups & families. Women with this gene mutation have an 80 to 90 ^% chance of developing breast cancer & a 40 to 50 ^% chance of developing ovarian cancer. Researchers have found that 1 ^% of Ashkenazi Jewish women have this gene mutation.ⁱ Some human retroviruses, eg^? the human immunodeficiency virus, (see box, page 927) cause lymphomas & other cancers of the blood system. ⁱ

infolaw results: The Directory: Public Bodies: Health: 54% (41)
http: //www. infolaw. co. uk/ lawfinder/ results. asp? lwftp= The+ Directory& lwfct= Public+ Bodies: +Health& lwfsc= ifllwbrws: unknown date

infolaw results: The Directory: Public Bodies: Health

Committee on Carcinogenicity of Chemicals in Food, Consumer Products & the Environment (COC)

Committee on the Mutagenicity of Chemicals in Food, Consumer Products & the Environment (COM)

Gene Therapy Advisory Committee (GTAC)

Human Fertilisation & Embryology Authority (HFEA)

Human Genetics Commission

BRCA genes - potential and problems [Oct 1997; 44-2]: 52% (42)
http: //www. jr2. ox. ac. uk/ bandolier/ band44/ b44- 2. html: unknown date

BRCA genes - potential and problems [Oct 1997; 44-2]

Genewatch: BRCA genes - potential & problems

ⁱ It pulled together information in 4 papers in that issue which examined new research on these genes involved with breast & ovarian cancer. The discovery of the so-called breast cancer genes, BRCA 1 in 1994 & BRCA 2 in the following year, were clearly landmarks in the study of breast cancer. The message that a woman with a strong family history of breast &/or ovarian cancer who carries a germ line mutation in one of these genes carries a lifetime risk of breast cancer of about 85%, & about 60% for ovarian cancer, is a frightening one.ⁱ

ⁱ There are some preliminary indications that mutations towards one end of the BRCA1 gene are more likely to lead to breast cancer while those towards the other end of the gene are more likely to give ovarian cancer.ⁱ ⁱ

Web potential: 51% (43)
http: //www. hi- europe. info/ files/ 1998_ 9/ web_ potential. htm: 29/5/2002

Web potential

ⁱ As this happens, the day-to-day mechanisms of trade & bureaucracy will be handled by agents, leaving humans to provide the inspiration & the intuition. There will be information on the Web which has a clearly defined meaning & can be analysed & traced by computer programs; there will be information, eg^? poetry & art, which requires the full human intellect for an understanding which will always be subjective. The computer renters the scene visibly as a software agent, doing anything it can to help us deal with the bulk of data, to take over the tedium of anything that can be reduced to a rational process, & to manage the scale of our human systems. All these ideas are just as relevant to information about the real world: about cars & people & stocks & shares & flights & food & rivers. HTML is a language for communicating a document for human consumption.ⁱ

The Environmental Literacy Council - Ecosystems: 50% (44)
http: //www. enviroliteracy. org/ category. php/ 3. html: unknown date

The Environmental Literacy Council - Ecosystems

its ^?known that human activities, mostly unintended, threaten biodiversity by altering habitats & introducing non-native species. There is general agreement on the importance of protecting biological diversity, especially since humans depend on the services provided by living organisms & ecosystems. There is less agreement on the best approaches to conservation & how to balance preservation of habitats with meeting human needs. World Resources 2000-2001: People & Ecosystems This millennial edition of World Resources focuses on 5 critical ecosystems that have been shaped by the interaction of physical environment, biological conditions, & human intervention: croplands, forests, coastal zones, freshwater systems, & grasslands.

16695: 47% (45)
http: //www. courtservice. gov. uk/ tribunals/ comtax/ decision/ 16695. htm: 13/3/2002

16695

HONG KONG FOOD Perry Yung & Agatha Yung trading as Chilli Restaurant & as Hong Kong Food Takeaway appeal against a decision of the Commissioners that Chilli Restaurant & Hong Kong Food are one business & that in consequence an assessment in the sum of19,154 was to be imposed. ⁱ "Hong Kong Food Takeaway (...) The Appellants further say that the businesses were established at different times, that the cuisine is different as the restaurant supplies Thai food & the takeaway supplies essentially Cantonese food, that there are separate lease agreements & utility bills, that trade suppliers treat them as separate businesses, that the IR^? accepts them as separate businesses & that there are separate... ⁱ Further, while the Appellants say that the restaurant provides Thai food & the takeaway essentially Chinese food, the heading of the menus quoted earlier don't support so clear a distinction.ⁱ

The Environmental Literacy Council - Food: 47% (46)
http: //www. enviroliteracy. org/ category. php/ 6. html: unknown date

The Environmental Literacy Council - Food

Advanced agricultural methods have made it possible to grow more food on fewer acres of land, which permits much land to be returned to forest & other uses. One of the most critical challenges of the next few decades is to find ways to increase production of food while minimizing environmental degradation.

Food Supply Food: Laws & Treaties Teaching Food

The Merck Manuals: 46% (47)
http: //www. merck. com/ pubs/: unknown date

The Merck Manuals

The Merck Veterinary Manual, Eighth Edition addresses the medical issues of companion, food, & zoo animals.

The book contains over 10,000 monographs; subject matter includes human & veterinary drugs, biologicals & natural products, agricultural chemicals, industrial & lab chemicals, & environmentally significant compounds.

The Environmental Literacy Council - Energy: 46% (48)
http: //www. enviroliteracy. org/ category. php/ 4. html: unknown date

The Environmental Literacy Council - Energy

Understanding the role of energy & human energy use is critical to an analysis of environmental issues.

Welcome to Cross - Fine Pens, Refills and Gifts: 46% (49)
http: //www. cross. com: unknown date

Welcome to Cross - Fine Pens, Refills and Gifts

Official A.T. Cross Company Site

Get your corporate logo on a Cross Pen!

UK Shopping UK britain food drink electrical computer household gift present gadget insurance flight ticket holiday house mobile telephone england britishShops in the UK: 44% (50)
http: //www. food. co. uk: 17/4/2002

UK Shopping UK britain food drink electrical computer household gift present gadget insurance flight ticket holiday house mobile telephone england britishShops in the UK

Welcome to Food.

Food Take-Away, Sweets, General, Organic, Superstores

Rel	Image	Reference
40%		Dangers of Genetic Engineering—Campaign for mandatory labeling of genetically engineered food
39%		Judicature: Judicature: Genes, Dreams, and Reality
38%		Department of Food Science and Technology List of Publications 1999
37%		FOOD.COM, INC.
37%		Genetics and plant biotechnology
37%		Human Genome News
36%		Merck: Partners In Innovation
34%		FOOD.COM, INC.
34%		Gene technology and plants-Key text
34%		FOOD.COM, INC.
34%		Department of Food Science and Technology List of Publications 1999
33%		Impacts: Genetic Engineering: Greenpeace USA
33%
32%		GMO Full
32%		Merck: Partners In Innovation
29%		Merck: Partners In Innovation
28%		Rewriting The Genome: the molecular biology of paradise
22%		hudsonvalleyfood.com - Food and Your Health

Aspect	Related Terms
Can GM food genes cross into humans?	Genetic Engineering; genetic modifications; Traditional Breeding; Gene technology; Genetic modification; High Pressure Bioscience and Biotechnology; recombinant DNA; New England Journal of Medicine; Merck Manuals; molecular biology of paradise; Antibiotic Resistence;

Subject Index

These subjects are all in the context of, and related to, your query. See also Relevant Documents | Related Images | Related Terms | Subject Index | Contacts

a b c d e f g h i j k l m n o p q r s t u v w x y z

	Subject	Example related documents
B	BIOTECHNOLOGY
E	ENGINEERING
F	FOODS
G	GENES
H	HUMANITY
R	RESISTANT

Contacts

These e-mails are arranged in order of relevance to your query. See also Relevant Documents | Related Images | Related Terms | Subject Index | Contacts

Rel	Contact	Address	X-ref
70%		gboland@uoguelph.ca?subject=CPS Website	Do Plants Have More Genes the Humans?
69%		zinnen@macc.wisc.edu	Biotechnology & Food
68%		true.food@wdc.greenpeace.org	True Food Network \| GMO FACTS
62%		food@afnovell.reading.ac.uk	Department of Food Science and Technology List of Publications 1999
61%		info@biointegrity.org	Basic Information Page...
60%		info@enviroliteracy.org	The Environmental Literacy Council - Biotechnology
58%		gordon@hudsonvalleyfood.com?subject=Hudson Valley Food	hudsonvalleyfood.com - Food and Your Health
58%	Denise K . Casey	caseydk@ornl.gov	Judicature: Judicature: Genes, Dreams, and Reality
55%	Email Us	gordon@hudsonvalleyfood.com	hudsonvalleyfood.com - Food and Your Health
53%		webmaster@safe-food.org	Dangers of Genetic Engineering—Campaign for mandatory labeling of genetically engineered food
43%		webmaster@biotechinfo.ie	Biotechinfo.ie - Biotech in Action: GM Food
43%		info@genes.co.uk	Rewriting The Genome: the molecular biology of paradise
37%	Cnessler @ vt . edu	Cnessler	VITAMINC.VTU
37%	netta @ vt . edu	netta	VITAMINC.VTU
37%	CSREES WebMaster	webmaster@reeusda.gov	CSREES -
27%	email	Bandolier@pru.ox.ac.uk	BRCA genes - potential and problems [Oct 1997; 44-2]
26%	Dr Ahmad Risk	editor@hi-europe.info	Web potential
26%	Dr David Rayne	david@healthcentreuk.co.uk	Web potential
26%	Harry Wood	harry@bjhcim.demon.co.uk?subject=HIE website	Web potential
26%		harry@BJHCIM.demon.co.uk	Web potential

Software Scientific

Research & summaries produced by Software Scientific Ltd

Concept Engine Results

Research based on Can GM food genes cross into humans?

Relevant Documents | Related Images | Related Terms | Subject Index | Contacts

Relevant Documents

IC9826.ASM

Impacts: Genetic Engineering: Greenpeace USA

True Food Network | GMO FACTS

Health Implications of Genetically Modified Foods

the genetiX snowball campaign - statements - Kathryn Tulip

Engineered Genes for Dinner

Biotechinfo.ie - Biotech in Action: GM Food

"http: //www. biotechinfo. ie/ content/ print_ friendly. asp? section_ id= 29& language_ id= 1"

The Environmental Literacy Council - Biotechnology

NFSD: Biotechnology and Food

Human Genome News

DECLARATION OF RABBI ALAN GREEN

True Food Network | GMO FACTS

"http: //www. iol. ie/ ~plugin/ badfoods. htm"

CDC - The Antibiotic Food-Chain Gang

Basic Information Page...

Simply News - The Risks of Genetic Engineering

Gene technology and plants-Key text

Gene technology provides a new tool

Austin Chronicle: Most Commonly Altered Crops

Genetically Modified Crops: Not "in England's Green and Pleasant Land"?

What is GM? | About GM | Genetic modification in New Zealand

Department of Food Science and Technology List of Publications 1999

Do Plants Have More Genes the Humans?

Biotechnology & Food

Selective Breeding & Inbreeding Depression

With this in mind, humans have gene banks to preserve the genetic information in the case of extinction, & nurture species that are at dangerously low population levels.

Ironically, the human interference that has disrupted so many species can now provide a means of placing genes into organisms, therefore preparing them for the above hypothetical scenarios eg ? an epidemic of disease.

Judicature: Judicature: Genes, Dreams, and Reality

Institute of Food Science & Technology: BSE/vCJD

BOVINE SPONGIFORM ENCEPHALOPATHY (BSE) & VARIANT CREUTZFELDT-JAKOB DISEASE (vCJD) IN HUMANS

VITAMINC.VTU

Genetics and plant biotechnology

hudsonvalleyfood.com - Food and Your Health

future.newsday.com / The Future of Food, Bioengineering

NFSD: Biotechnology and Food

GMO Full

CSREES -

"http: //www. ausbiotech. org/ edu3. html"

Guardian Unlimited | The Guardian | Cult determined to clone humans

The Environmental Literacy Council - Land

Dangers of Genetic Engineering—Campaign for mandatory labeling of genetically engineered food

The Environmental Literacy Council - Environment & Society

THE MERCK MANUAL--Home Edition, Sec. 15, Ch. 162, Causes and Risks of Cancer

infolaw results: The Directory: Public Bodies: Health

BRCA genes - potential and problems [Oct 1997; 44-2]

Genewatch: BRCA genes - potential & problems

Web potential

The Environmental Literacy Council - Ecosystems

16695

The Environmental Literacy Council - Food

The Merck Manuals

The Environmental Literacy Council - Energy

Welcome to Cross - Fine Pens, Refills and Gifts

UK Shopping UK britain food drink electrical computer household gift present gadget insurance flight ticket holiday house mobile telephone england britishShops in the UK

Related Images

Related Terms

Subject Index

Contacts

Ironically, the human interference that has disrupted so many species can now provide a means of placing genes into organisms, therefore preparing them for the above hypothetical scenarios eg^? an epidemic of disease.